Sequence ID | >WENV170646250 |
Genome ID | JQGG01084757 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 241 |
End posion on genome | 169 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tccttcgaga |
tRNA gene sequence |
GGGGGTTTAGCTCAGTTGGTAGAGCGTCTGCCTTACAAGCAGAATGTCAGCGGTTCGAGA |
Downstream region at tRNA end position |
aaaatatcct |
Secondary structure (Cloverleaf model) | >WENV170646250 Val TAC a Atta aaaatatcct G - C G + T G - C G - C G + T T + G T T A G T T T G C C A T G A A | + | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |