Sequence ID | >WENV170646255 |
Genome ID | JQGG01086548 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 321 |
End posion on genome | 246 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctatcgttgt |
tRNA gene sequence |
CGGCTCGTGGCGCAAGTGGCAGACGCGGCACGTTCAGACCGTGCAGATCGGGGTTCGAAT |
Downstream region at tRNA end position |
ccccaacgtg |
Secondary structure (Cloverleaf model) | >WENV170646255 Leu CAG t ACCA ccccaacgtg C - G G - C G - C C - G T - A C - G G - C T A T G C C C C A G A A G | | | | | G T C G C G C G G G G C G | | | T T G A C G C C A G G AGAT G - C C - G A - T C - G G - C T C T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |