Sequence ID | >WENV170646256 |
Genome ID | JQGG01086852 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 178 |
End posion on genome | 251 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cttagacttc |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGGAGAGCGCCTGGTTTGCAACCAGGAGGTCACCGGTTCGAGC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646256 Ala TGC c ACnn nnnnnnnnnn G - C G - C G + T G - C A - T A - T T - A C G T T G G C C A C G A A | | | | | G T C T C G A C C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C G - C T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |