Sequence ID | >WENV170646258 |
Genome ID | JQGG01089638 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 104 |
End posion on genome | 178 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gtccagccaa |
tRNA gene sequence |
GCACCCGTAGCTCAATTGGATAGAGCATCGGTCTACGGAACCGAAGGTTACAGGTTCGAG |
Downstream region at tRNA end position |
ttccgatctt |
Secondary structure (Cloverleaf model) | >WENV170646258 Arg ACG a ACtt ttccgatctt G + T C - G A - T C - G C - G C - G G - C C G T T G T C C A T A A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A AGGTT T - A C - G G - C G - C T - A C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |