Sequence ID | >WENV170646262 |
Genome ID | JQGG01093165 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 115 |
End posion on genome | 187 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggggcaagtt |
tRNA gene sequence |
GGCGAGGTAGCTCAACGGTGGAGCAGTGGACTCATAAGCCATTGGATGTGGGTTCAAATC |
Downstream region at tRNA end position |
ttccttttaa |
Secondary structure (Cloverleaf model) | >WENV170646262 Met CAT t ACtt ttccttttaa G - C G - C C - G G - C A - T G - C G - C T A T C A C C C A A A A | | | | | A C C T C G G T G G G C G | | | | T T G G A G C T G A TGGAT G + T T - A G - C G - C A G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |