Sequence ID | >WENV170646265 |
Genome ID | JQGG01095677 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 90 |
End posion on genome | 6 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgcctcctta |
tRNA gene sequence |
GCCGGAATGGCGGAATCGGTAGACGCGCACGACTCAAACTCGTGTTCCGAAAGGAGTGAG |
Downstream region at tRNA end position |
tgtacnnnnn |
Secondary structure (Cloverleaf model) | >WENV170646265 Leu CAA a ACCA tgtacnnnnn G - C C - G C - G G - C G - C A - T A - T T G T C T C T C A T A A G | | | | | G C G G C G G A G A G C G | | | T T G A C G C T A G G TTCCGAAAGGAGT C - G A - T C - G G - C A - T C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |