Sequence ID | >WENV170646268 |
Genome ID | JQGG01103377 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 240 |
End posion on genome | 165 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccggccaaaa |
tRNA gene sequence |
GCCACCCTAGCTCAGTTGGTAGAGCATTCGATTCGTAATCGAAAGGTCGTCGGTTCAAAT |
Downstream region at tRNA end position |
taaaatcaac |
Secondary structure (Cloverleaf model) | >WENV170646268 Thr CGT a TCCA taaaatcaac G - C C - G C - G A - T C - G C - G C - G T A T C A G C C A T G A A | | | | | A T C T C G G T C G G C G | | | | T T G G A G C T A A AGGTC T - A T - A C - G G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |