Sequence ID | >WENV170646269 |
Genome ID | JQGG01104510 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 84 |
End posion on genome | 9 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccccgtccta |
tRNA gene sequence |
GCCGGATTAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACT |
Downstream region at tRNA end position |
tttcattgnn |
Secondary structure (Cloverleaf model) | >WENV170646269 Thr CGT a ACCA tttcattgnn G - C C - G C - G G - C G - C A - T T - A T C T T A T C C A T G A A + | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |