Sequence ID | >WENV170646270 |
Genome ID | JQGG01105505 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 168 |
End posion on genome | 244 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
catcagtcaa |
tRNA gene sequence |
GGGCGACTAGCTCAGTTGGTTAGAGCGCTACTATCACAAAGTAGAGGTCACTGGTTCGAG |
Downstream region at tRNA end position |
caccgatgcg |
Secondary structure (Cloverleaf model) | >WENV170646270 Val CAC a ACCA caccgatgcg G - C G - C G - C C - G G - C A - T C - G T G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G T - A A A T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |