Sequence ID | >WENV170646272 |
Genome ID | JQGG01108222 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 160 |
End posion on genome | 85 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aagataatgc |
tRNA gene sequence |
AGGCCAGTAGCTCTAATGGCAGAGCGCCGGACTCCAAATCCGGATGCTGGGGGTTCAAGT |
Downstream region at tRNA end position |
gtttttcccg |
Secondary structure (Cloverleaf model) | >WENV170646272 Trp CCA c GCCA gtttttcccg A - T G - C G - C C - G C - G A - T G - C T G T C T C C C A A A T A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C C A G ATGCT C - G C - G G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |