Sequence ID | >WENV170646273 |
Genome ID | JQGG01109334 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 109 |
End posion on genome | 193 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cgaacctgat |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTATACGCGTACGTTTGAGGGGCGTATGAGGCAACTCATCCG |
Downstream region at tRNA end position |
ctcctccctt |
Secondary structure (Cloverleaf model) | >WENV170646273 Leu GAG t ACCA ctcctccctt G - C C - G C - G C - G A - T G - C G - C T G T G G C C C A T A A G | | | | | A T G G C G C C G G G C G | | | T T G A C G C T A T G TGAGGCAACTCAT T - A A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |