Sequence ID | >WENV170646279 |
Genome ID | JQGG01123658 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 243 |
End posion on genome | 168 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gtttttctgc |
tRNA gene sequence |
TGGGGTATCGCCAAGTTGGTAAGGCAGTAGATTTTGATTCTACCATTCGCAGGTTCAAGT |
Downstream region at tRNA end position |
ttatttttag |
Secondary structure (Cloverleaf model) | >WENV170646279 Gln TTG c TCCA ttatttttag T - A G - C G - C G - C G - C T - A A - T T G T C G T C C A T G A C | | | | | A T A C C G G C A G G C G | | | T T G A G G C T A A CATTC G - C T - A A - T G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |