Sequence ID | >WENV170646280 |
Genome ID | JQGG01124165 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 126 |
End posion on genome | 199 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ataaaaaacc |
tRNA gene sequence |
GGGCTCGTGGTCTAGCTGGTTATGACGTCGCCTTCACACGGCGGAGGTCAGGAGTTCGAA |
Downstream region at tRNA end position |
cttttctgga |
Secondary structure (Cloverleaf model) | >WENV170646280 Val CAC c Atag cttttctgga G - C G - C G - C C - G T - A C - G G - C T A T T C C T C A C G A G | | | | | G T T C T G A G G A G C G | | | T T G T G A C T T A G AGGTC T + G C - G G - C C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |