Sequence ID | >WENV170646283 |
Genome ID | JQGG01125736 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 192 |
End posion on genome | 277 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttccttgccc |
tRNA gene sequence |
GCCCGGGTGGTGAAATGGTAGACACAGGGGACTTAAAATCCCTTGCTCGCAAGAGCGTGT |
Downstream region at tRNA end position |
agatgaccgg |
Secondary structure (Cloverleaf model) | >WENV170646283 Leu TAA c ACCC agatgaccgg G - C C - G C - G C - G G + T G - C G - C T G T C A C C C A T A A G | | | | | G G A G T G G T G G G C G | | | T T T A C A C A G A TGCTCGCAAGAGCGT G + T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |