Sequence ID | >WENV170646284 |
Genome ID | JQGG01128539 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 110 |
End posion on genome | 184 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ttagaattcA |
tRNA gene sequence |
TCCCGGCTAGCTCAGTCGGTAGAGCGTGAGACTCTTAATCTTAAGGTCATGGGTTCGAGC |
Downstream region at tRNA end position |
actttttcct |
Secondary structure (Cloverleaf model) | >WENV170646284 Lys CTT A TTat actttttcct T C C - G C - G C - G G + T G + T C - G C G T T A C C C A T G A A | | | | | G C C T C G A T G G G C G | | | | T T G G A G C T A G AGGTC T - A G + T A - T G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |