Sequence ID | >WENV170646289 |
Genome ID | JQGG01139784 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 104 |
End posion on genome | 194 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgaggcgatt |
tRNA gene sequence |
GGATGGGTGGCCGAGTGGTCTAAGGCAGGTCTTTGCTAAAGACCCAGACCCCAAAAGGGT |
Downstream region at tRNA end position |
ttttcccgat |
Secondary structure (Cloverleaf model) | >WENV170646289 Ser GCT t GCCA ttttcccgat G - C G - C A - T T C G - C G - C G - C T A T T C T C C A T G A G + | | | | G G G C C G G G A G G C G | | | T T T A G G C C T A A CAGACCCCAAAAGGGTCTC G - C G - C T - A C - G T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |