Sequence ID | >WENV170646292 |
Genome ID | JQGG01147023 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 198 |
End posion on genome | 124 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcataaatga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTCGGTAGCTCGCGAGGCTCATAACCTCGAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
cgacccgcca |
Secondary structure (Cloverleaf model) | >WENV170646292 Met CAT a ACtt cgacccgcca C A G - C C - G G - C G - C G - C G - C T A T T G T C C A T G A G | | | | | G T C G A G A C A G G C C | | | | T T G G C T C G T A G AGGTC C - G G - C A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |