Sequence ID | >WENV170646297 |
Genome ID | JQGG01157542 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 72 |
End posion on genome | 148 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cagttacttc |
tRNA gene sequence |
GGGCGGTTAGCTCAGCTGGCTAGAGCGCAGCGTTGACATCGCTGAGGTCGGGTGTTCGAG |
Downstream region at tRNA end position |
atcggtcctc |
Secondary structure (Cloverleaf model) | >WENV170646297 Val GAC c ACCG atcggtcctc G - C G - C G - C C - G G A G G T - A C G T C C C A C A C G A A | | | | | G T C T C G G G G T G C G | | | | T T G G A G C C T A G AGGTC C - G A - T G - C C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |