Sequence ID | >WENV170646298 |
Genome ID | JQGG01157909 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 149 |
End posion on genome | 221 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ctcttagtaa |
tRNA gene sequence |
GGTTCCATGGTCTAATGGTTATGACGGCTGATTTTGGCTCAGCAAGCCGGGGTTCGATTC |
Downstream region at tRNA end position |
cgtttttgcc |
Secondary structure (Cloverleaf model) | >WENV170646298 Gln TTG a TCtt cgtttttgcc G - C G - C T - A T - A C - G C - G A - T T T T G C C C C A T A A G | | | | | G G T C T G C G G G G C G | | | T T T T G A C T A G AAGC G - C C - G T - A G - C A - T T C T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |