Sequence ID | >WENV170646300 |
Genome ID | JQGG01162828 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 121 |
End posion on genome | 206 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcttcccttg |
tRNA gene sequence |
GCCGGGATGGCGGAATGGTAGACGCAGTGGACTCAAAATCCACCGGTAGCGATACCGTGC |
Downstream region at tRNA end position |
aaaacaatcg |
Secondary structure (Cloverleaf model) | >WENV170646300 Leu CAA g ACCA aaaacaatcg G - C C - G C - G G - C G - C G - C A - T T G T C G C T C A T A A G | | | | | G G G G C G G C G A G C G | | | T T T A C G C A G A CGGTAGCGATACCGT G - C T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |