Sequence ID | >WENV170646303 |
Genome ID | JQGG01169183 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 234 |
End posion on genome | 158 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
nnagccacac |
tRNA gene sequence |
GCACTCATAGCTCAGCTGGATAGAGTTCCCGGCTACGAACCGGGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tacagcaaaa |
Secondary structure (Cloverleaf model) | >WENV170646303 Arg ACG c GCCA tacagcaaaa G - C C - G A - T C - G T - A C - G A - T T A T C C T C C A C G A A | | | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A T CGGTC C - G C - G C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |