Sequence ID | >WENV170646310 |
Genome ID | JQGG01188672 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 61 |
End posion on genome | 148 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgttggtttT |
tRNA gene sequence |
GCCGAGGTGGCTCAGACCGGTACGGCGCGAGCCTGGAAAGCTCGTGGGGCGTCAGCTCCG |
Downstream region at tRNA end position |
tatttctagg |
Secondary structure (Cloverleaf model) | >WENV170646310 Ser GGA T GTtt tatttctagg G - C C - G C - G G - C A - T G - C G - C T A T T C C T C A A G A G | | | | | A C C T C G A G G A G C C + | | T T G C G G C G T A G TGGGGCGTCAGCTCCGC C - G G - C A - T G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |