Sequence ID | >WENV170646312 |
Genome ID | JQGG01192478 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 201 |
End posion on genome | 128 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggcgcgtgcg |
tRNA gene sequence |
GGGCCCATAGCTCAGCTGGTGAGAGCGACGGACTCATAATCCGTTGGTCCAAGGTTCAAG |
Downstream region at tRNA end position |
cctcccgccg |
Secondary structure (Cloverleaf model) | >WENV170646312 Met CAT g Attg cctcccgccg G - C G - C G - C C - G C - G C - G A - T T G T G T T C C A C G A A | | | | | A T C T C G C A A G G C G | | | | T T G G A G C T G A G TGGTC A - T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |