Sequence ID | >WENV170646313 |
Genome ID | JQGG01197534 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 140 |
End posion on genome | 214 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acttacggac |
tRNA gene sequence |
TGCGGGGTAGAGCAGAGGCAGCTCGCAGGGTTCATACCCCTGAGGTCGTGGGTTCAAATC |
Downstream region at tRNA end position |
agacaaaatg |
Secondary structure (Cloverleaf model) | >WENV170646313 Met CAT c ACAA agacaaaatg T T G - C C - G G - C G - C G - C G + T T A T C A C C C A G A A | | | | | A A C G A G G T G G G C G | | | | T T G G C T C C A G AGGTC C - G A - T G - C G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |