Sequence ID | >WENV170646314 |
Genome ID | JQGG01197893 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 7 |
End posion on genome | 96 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
nnnatttatT |
tRNA gene sequence |
GGAGAGGTGGCAGAGCTCGGTTGATTGCGCACGACTCGAAATCGTGTATACCTTCGGGTA |
Downstream region at tRNA end position |
caagatattg |
Secondary structure (Cloverleaf model) | >WENV170646314 Ser CGA T GTCg caagatattg G - C G - C A - T G - C A - T G - C G - C T A T C C C C C A T C G A G | | | | | A C G A C G G G G G G C G + | | | T T G T T G C T T G A G TATACCTTCGGGTATC C - G A - T C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |