Sequence ID | >WENV170646315 |
Genome ID | JQGG01199003 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 184 |
End posion on genome | 113 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaacacaatc |
tRNA gene sequence |
GCATGAATAGCTCAATGGTAGAGCGACCGACTGGAATTCGGTAAGTTGCGGGTTCAAATC |
Downstream region at tRNA end position |
aaagcgaaag |
Secondary structure (Cloverleaf model) | >WENV170646315 Ser GGA c Aacc aaagcgaaag G - C C - G A - T T T G - C A - T A - T T A T C G T C C A A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T A G AAGTT A - T C - G C - G G - C A - T C T T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |