Sequence ID | >WENV170646316 |
Genome ID | JQGG01201281 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 72 |
End posion on genome | 146 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
taaatttaat |
tRNA gene sequence |
GGCCCGTTGGTCAAGCGGTTAAGACGCCACCCTCTCAAGGTGGAATCATGAGTTCGATTC |
Downstream region at tRNA end position |
tatatgtaac |
Secondary structure (Cloverleaf model) | >WENV170646316 Glu CTC t ACCA tatatgtaac G - C G + T C - G C - G C - G G - C T - A T T T T G C T C A C G A G | + | | | G G A C T G A T G A G C G | | | T T T A G A C T A G AATC C - G C - G A - T C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |