Sequence ID | >WENV170646323 |
Genome ID | JQGG01208568 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 179 |
End posion on genome | 103 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccaggagcac |
tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGCCAGAGCGACGCACTCGTAATGCGTAGGTCTGGGGTTCGAT |
Downstream region at tRNA end position |
ccccgccgtg |
Secondary structure (Cloverleaf model) | >WENV170646323 Thr CGT c TCCA ccccgccgtg G - C C - G C - G G - C C - G C - G T - A T T T A C C C C A T G A A | | | | | G T C T C G T G G G G C G | | | | T T G G A G C C C A G AGGTC A - T C - G G - C C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |