Sequence ID | >WENV170646325 |
Genome ID | JQGG01209102 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 53 |
End posion on genome | 150 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
gtttcctcaa |
tRNA gene sequence |
GGAAGTGCCAAGGTCACTGGTGGGCCTCCTGGACTTCAAATCCAGTGTGGGGCGCTAGAA |
Downstream region at tRNA end position |
gtaaattcaa |
Secondary structure (Cloverleaf model) | >WENV170646325 SeC(p) TCA a GCCA gtaaattcaa G - C G - C A - T A - T G - C T - A G - C C - G T T C T A C C C A C A C A + | | | | G T T G G A G T G G G C G + | | | T T G G C C T T G G C TGTGGGGCGCTAGAACCGTCCCAG C - G T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |