Sequence ID | >WENV170646326 |
Genome ID | JQGG01214524 |
Phylum/Class | [JQGG] wastewater metagenome; domestic wastewater sediment treated with nitrate and nitrite at 100mg /litre each |
Species | |
Start position on genome | 213 |
End posion on genome | 137 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ggtcccctgc |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGCTAGAGCGCATCGTTCGCAACGATGAGGTCGGCGGTTCGAT |
Downstream region at tRNA end position |
agggtccgga |
Secondary structure (Cloverleaf model) | >WENV170646326 Ala CGC c ACCA agggtccgga G - C G - C G + T G - C G - C T - A G - C T T T T C G C C A T G A A + | | | | G T C T C G G G C G G C G | | | | T T G G A G C C T A G AGGTC C - G A - T T - A C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |