Sequence ID | >WENV170646329 |
Genome ID | JQGR01000014 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 22876 |
End posion on genome | 22961 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ggtgtgaagt |
tRNA gene sequence |
GCCCAAGTGGCGGAATGGTAGACGCAGGGGATTCAAAATCCCCCGCCTTTGCGGGCGTGC |
Downstream region at tRNA end position |
ctcatttcag |
Secondary structure (Cloverleaf model) | >WENV170646329 Leu CAA t ACCA ctcatttcag G + T C - G C - G C - G A - T A - T G - C T G T C G G C C A T A A G | | | | | G G G G C G G C C G G C G | | | T T T A C G C A G A CGCCTTTGCGGGCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |