Sequence ID | >WENV170646331 |
Genome ID | JQGR01000018 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 2971 |
End posion on genome | 2896 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aagcccggcc |
tRNA gene sequence |
GCCTCAATAGCTCAGCTGGTAGAGCAGGTCCTTCGTAAGGACAAGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
catcttcaac |
Secondary structure (Cloverleaf model) | >WENV170646331 Thr CGT c ACCA catcttcaac G - C C - G C - G T - A C - G A - T A - T T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A G - C T - A C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |