Sequence ID | >WENV170646332 |
Genome ID | JQGR01000020 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 25313 |
End posion on genome | 25388 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gaaaaaggtt |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGTAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGACC |
Downstream region at tRNA end position |
aatctctctc |
Secondary structure (Cloverleaf model) | >WENV170646332 Ala GGC t ACCA aatctctctc G - C G - C G + T G - C C - G C - G T - A C C T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |