Sequence ID | >WENV170646335 |
Genome ID | JQGR01000028 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 21492 |
End posion on genome | 21408 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctaaggttat |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGCGAGGCGTGGG |
Downstream region at tRNA end position |
aagatgataa |
Secondary structure (Cloverleaf model) | >WENV170646335 Leu TAG t ACCA aagatgataa G - C C - G G - C G - C G - C T - A G - C T G T T T C C C A T A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCGAGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |