Sequence ID | >WENV170646339 |
Genome ID | JQGR01000040 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 2528 |
End posion on genome | 2442 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tgacccacgt |
tRNA gene sequence |
GCCCGCGTGGTGGAATGGTAGACACAGGAGACTTAAAATCTCTAGGCCGTATAGGCCGTG |
Downstream region at tRNA end position |
ataaaaacag |
Secondary structure (Cloverleaf model) | >WENV170646339 Leu TAA t ACCA ataaaaacag G + T C - G C - G C - G G - C C - G G - C T G T C G G C C A T A A G | | | | | G G G G T G G C C G G C G | | | T T T A C A C A G A AGGCCGTATAGGCCGT G + T G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |