Sequence ID | >WENV170646340 |
Genome ID | JQGR01000044 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 1950 |
End posion on genome | 2024 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tccaaatttt |
tRNA gene sequence |
TCGGCTGTAGCTCAGTGGTAGAGCGCCTGACTGTTAATCAGGATGTCGTTGGTTCGATCC |
Downstream region at tRNA end position |
gaaatgaaag |
Secondary structure (Cloverleaf model) | >WENV170646340 Asn GTT t GCCA gaaatgaaag T - A C - G G - C G - C C - G T - A G - C C T T C A A C C A G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |