Sequence ID | >WENV170646345 |
Genome ID | JQGR01000062 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 19117 |
End posion on genome | 19041 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
accctactgt |
tRNA gene sequence |
CGCGGGATGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
acacaaacac |
Secondary structure (Cloverleaf model) | >WENV170646345 Met CAT t ACCA acacaaacac C A G - C C - G G - C G - C G - C A - T T A T C A T C C A C G A G | | | | | A C C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |