Sequence ID | >WENV170646350 |
Genome ID | JQGR01000113 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 2615 |
End posion on genome | 2701 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
agctagactt |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGAGGTAACACTCGTG |
Downstream region at tRNA end position |
tatccctcca |
Secondary structure (Cloverleaf model) | >WENV170646350 Leu GAG t ACCA tatccctcca G - C C - G G - C G - C T - A C - G G - C T G T C A C C C A T A A G | | | | | G T G G C G G T G G G C G | | | T T G A C G C T A G G TGAGGTAACACTCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |