Sequence ID | >WENV170646366 |
Genome ID | JQGR01000243 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 4251 |
End posion on genome | 4178 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gtccccgagc |
tRNA gene sequence |
GCGGGTATGGTGAAATGGTATCATGCGAGCTTCCCAAGCTTAAGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
cctcccccgc |
Secondary structure (Cloverleaf model) | >WENV170646366 Gly CCC c TCCA cctcccccgc G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A G | | | | | G T A G T G G C G G G C G | | | + T T G T C A T T A G AGGT C A G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |