Sequence ID | >WENV170646379 |
Genome ID | JQGR01000547 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 3352 |
End posion on genome | 3442 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
actgtaaatt |
tRNA gene sequence |
GGACAGATGGGTGAGCTGGCTGAAACCACTTCCCTGCTAAGGAAGCGTACTGGCAACGGT |
Downstream region at tRNA end position |
taaaaataaa |
Secondary structure (Cloverleaf model) | >WENV170646379 Ser GCT t GCCA taaaaataaa G - C G - C A - T C - G A - T G - C A - T T A T C T C C C A T C G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CGTACTGGCAACGGTACC C - G T - A T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |