Sequence ID | >WENV170646386 |
Genome ID | JQGR01000616 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 957 |
End posion on genome | 1041 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tttctcaaac |
tRNA gene sequence |
GCGACCGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGCCTTAGGGTGTACG |
Downstream region at tRNA end position |
taatactttt |
Secondary structure (Cloverleaf model) | >WENV170646386 Leu GAG c ACCA taatactttt G - C C - G G - C A - T C - G C - G G - C T A T T G C T C A T A A G | | | | | A T A G T G A C G A G C G | | | T T G A C A C T A G G TGCCTTAGGGTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |