Sequence ID | >WENV170646396 |
Genome ID | JQGR01001157 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 1809 |
End posion on genome | 1895 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaaacaaagt |
tRNA gene sequence |
GCCCGTATGGTGAAATTGGTAAACACGTTGGATTCAAAATCCAATGACTTCACGGTCTTG |
Downstream region at tRNA end position |
taaataaact |
Secondary structure (Cloverleaf model) | >WENV170646396 Leu CAA t ACCA taaataaact G + T C - G C - G C - G G - C T - A A - T T G T C A G C C A T A A G | | | | | A T A G T G G T C G G C G | | | T T G A C A C T A A G TGACTTCACGGTCTT T - A T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |