Sequence ID | >WENV170646403 |
Genome ID | JQGR01001633 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 1358 |
End posion on genome | 1444 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atttaacagt |
tRNA gene sequence |
GCGAGCGTGGCGGAATAGGTAGACGCGTTGGACTTAAAATCCAATTCCGGTTTCGGAGTG |
Downstream region at tRNA end position |
cttttataca |
Secondary structure (Cloverleaf model) | >WENV170646403 Leu TAA t ACCA cttttataca G - C C - G G - C A - T G + T C - G G - C T T T C A G C C A T A A G | | | | | G A G G C G G T C G G C G | | | T T G A C G C T A G G TTCCGGTTTCGGAGT T - A T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |