Sequence ID | >WENV170646404 |
Genome ID | JQGR01001633 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 1474 |
End posion on genome | 1562 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttttatagct |
tRNA gene sequence |
AGAGGGTTGCCAGAGTTGGTCGAATGGACCGGTTTTGAAAACCGGCGAGGTTCACGCCTC |
Downstream region at tRNA end position |
ctataaataa |
Secondary structure (Cloverleaf model) | >WENV170646404 Ser TGA t GCCA ctataaataa A - T G - C A - T G - C G - C G - C T + G T A T T T C C C A T T G A G + | | | | G G G A C C G A G G G C G | | | T T T A T G G C G A A CGAGGTTCACGCCTCC C - G C - G G - C G - C T - A T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |