Sequence ID | >WENV170646405 |
Genome ID | JQGR01001633 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 1617 |
End posion on genome | 1692 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tatctaaaac |
tRNA gene sequence |
GGAGCTATAGCAAAGTTGGTAATGCCCCGGATTGCAAATCCGGTATGCGTTGGTTCGAGT |
Downstream region at tRNA end position |
ttttannnnn |
Secondary structure (Cloverleaf model) | >WENV170646405 Cys GCA c TCCA ttttannnnn G - C G - C A - T G - C C - G T - A A - T T G T C A G C C A T G A A | | + | | G T A A C G G T T G G C G | | | T T G A T G C T A C TATGC C - G C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |