Sequence ID | >WENV170646431 |
Genome ID | JQGR01003773 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 425 |
End posion on genome | 509 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gacatactat |
tRNA gene sequence |
GCGGATGTGGTGAAATTGGTATACACGCTAGACTTAGGATCTAGTGCTTTACGGCGTGAA |
Downstream region at tRNA end position |
ctattttaaa |
Secondary structure (Cloverleaf model) | >WENV170646431 Leu TAG t ACCA ctattttaaa G - C C - G G - C G - C A - T T - A G - C T G T T T T C C A T A A G + | | | | A T A G T G G A A G G C G | | | T T G A C A C T A T G TGCTTTACGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |