Sequence ID | >WENV170646445 |
Genome ID | JQGR01005102 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 104 |
End posion on genome | 194 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
atagatttct |
tRNA gene sequence |
GGAGAGATGTCCGAGTGGCTTAAGGTGGTGGTCTCGAAAACCGCTGTGCGGCACAACCGC |
Downstream region at tRNA end position |
attacaaggg |
Secondary structure (Cloverleaf model) | >WENV170646445 Ser CGA t GCTA attacaaggg G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | A G G C C T G A G G G C G | | T T C A G G T T T A G TGTGCGGCACAACCGCACC G - C T + G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |