Sequence ID | >WENV170646456 |
Genome ID | JQGR01007851 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 364 |
End posion on genome | 274 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttataatagt |
tRNA gene sequence |
GGAGGAATACCCAAGTCTGGCTGAAGGGATCGGTCTTGAAAACCGACAGGCTGTAAAAGG |
Downstream region at tRNA end position |
tcagaagttt |
Secondary structure (Cloverleaf model) | >WENV170646456 Ser TGA t GCCA tcagaagttt G - C G - C A - T G - C G - C A - T A - T T A T C T C C C A C T G A A | + | | | G T A C C C G G G G G C G | | | T T G A G G G C T G A A CAGGCTGTAAAAGGCGC T - A C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |