Sequence ID | >WENV170646470 |
Genome ID | JQGR01010582 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 241 |
End posion on genome | 158 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
attattaaat |
tRNA gene sequence |
GCGACCGTGGTGGAACGGTAGACACGCTACCTTGAGGGGGTAGTGCCTACGGGTGTGAGA |
Downstream region at tRNA end position |
tctacaacta |
Secondary structure (Cloverleaf model) | >WENV170646470 Leu GAG t ACCA tctacaacta G - C C - G G - C A - T C - G C - G G - C T A T C T C T C A C A A G | | | | | A G G G T G G A G A G C G | | | T T T A C A C A G G TGCCTACGGGTGT C - G T - A A - T C - G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |