Sequence ID | >WENV170646479 |
Genome ID | JQGR01012362 |
Phylum/Class | [JQGR] bioreactor metagenome; continuous culture inoculated with microbial biomass from the upper 2 cm of a marine |
Species | |
Start position on genome | 71 |
End posion on genome | 161 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cataacggtt |
tRNA gene sequence |
GGAGTAGTACTCAAGTGGCTGAAGAGGCGCCCCTGCTAAGGGTGTAGACCAGGAGACTGG |
Downstream region at tRNA end position |
tcgttatttg |
Secondary structure (Cloverleaf model) | >WENV170646479 Ser GCT t GCCA tcgttatttg G - C G - C A - T G - C T + G A - T G - C T A T C T C C C A T G A A | | | | | A G A C T C G A G G G C G | | | T T C A G A G T G A G TAGACCAGGAGACTGGTGC C - G G + T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |